Nerd Beacon #2

Hey everyone. It's been a couple weeks since my last post, I've been hard at work trying to do multiple things to get my research going:

1. Find variable microsatellites so I can conduct population genetics studies.
2. Document my various collecting sites (also known as localities) using GPS and Google Earth, so I can have exact distances between collections.
3. Begin to measure traits (phenotypes) of the Funaria I collected, because the goal is to correlate relatedness with these traits.

I've been having trouble with all three, unfortunately. For the microsats, I've been having glitches with the equipment and my materials. One of our PCR machines broke while my experiment was running, and so that got ruined. I also am having trouble finding a program that lets me do all the sophisticated distance analysis I want that is also free. Finally, measuring traits is a bit difficult due to the shapes of the organisms.

In an evolutionary sense, the "fitness" of an organism is based upon how many offspring it has. For Funaria, the obvious thing to measure, then, is the number of spores each organism produces. However, this is a pretty time-consuming operation. Since each sporophyte produces 500,000 spores, I'm hoping I can use some other measure as a proxy for spore counts. One option is to measure the size of the capsule. However, this can be a pain because the capsule of Funaria is so oblique, rounded, and asymmetric. I'm meeting with a professor who specializes in measuring organisms tomorrow, so I hope he can help!

In the meantime, my only option is to measure the spores. The way I do this is by carefully rupturing a sporophyte into a small test tube that contains exactly one milliliter (mL) of sterile water. I then remove 1/10th of that (1 microliter) and place it on a special microscope slide known as a hemocytometer. The grids on that slide will allow me to count a small number of spores and then extrapolate to the whole sample. To count, I use what I consider to be nerd beacon #2- the clicker-counter:



This little device makes me happy on a number of levels- it keeps track of how many spores I see, sure. But more importantly, it is frequently used in baseball to keep track of pitch counts. Any combination of biology and baseball is definitely one I cherish.

Definition Train: Microsatellites

Next up stop for the definition train is not a concept but a technique, and one essential to my work. Microsatellites are also known as Short Tandem Repeats, and are DNA regions that contain a lot of repetitive DNA. Because they are very variable within a population, they're known as a "DNA Fingerprinting" technique, and are used for all kinds of purposes including forensics (they're featured on CSI quite often). Here's a little bit about how they are designed, and how they work.

Our DNA contains a lot of junk. That statement is less true than when it was first realized that despite the six billion base pairs of the human genome, less than a tenth of that is actually used for constructing proteins. Some of the rest of the genome is used to regulate gene expression, while much of it remains junk. However, junk is good for population geneticists, because junk DNA is not usually subject to natural selection; there aren't any constraints keeping a particular DNA sequence intact. They are free to vary according to the rules of chance, and those rules allow scientists to deduce how related two organisms are.

One type of these DNA regions contains repetitive bases- remember, the DNA code has four letters (A, G, C, and T). In these regions, the same two or three letters repeat many times. For example, it may look like this:

GATCAGTAAGATATATATATATATATATATATATATATATGGGTGCTCAGAT

In this case, this individual has the microsatellite "AT" repeated 16 times. The number of repeats turns out to be pretty variable, even within a population: one individual may have 16 repeats, as above, while a neighbor may have 12 repeats or 20 repeats. The interesting thing is that there are many of these regions (also known as loci) in the genome, and so one can have a pretty complete profile of an individual by looking at 5 to 15 of these loci:

Microsat Individual 1 Individual 2
1.............. 16................ 18
2............. 200 ............. 225
3.............. 75 ............... 75
4 ............. 87................ 90
5............ 103............... 115

This is a typical result of a microsat analysis; a machine reads off how many copies there are for each sample at each locus. With five loci, we can see that even though the two individuals are identical at locus 3, they are clearly two different individuals. Perhaps they are related, though. In forensics, crime labs will typically look at 13 loci to make a match between a suspect and a DNA sample from the crime scene. You might also hear on CSI or Court TV when it's said that the suspect has "7 of 13 alleles in common." What they mean is that at 7 of the 13 loci, two samples have identical numbers of repeats. This is extremely unlikely to be due to chance, and so it is pretty likely that the two samples come from DNA of blood-relatives (probably siblngs or parent-offspring).

It is one of my goals to investigate the matting patterns in mosses, by knowing who mates with whom. To do this, I need to find the regions (or loci) that have the microsatellites. Doing that from scratch is actually a time (3-4 months) and cost ($6000) intensive process. I'm fortunate that Funaria is in the same family as Physcomitrella, the lab rat of the moss world. Physcomitrella recently has its entire genome sequenced, and has a lot of researchers working on it, including those who have designed microsattelites for the species. In a paper, they also noted that many of the regions for Physcomitrella also work for Funaria. Those scientists have graciously supplied me with materials to discover whether those regions are variable enough for me to distinguish two moss individuals as they do with humans on CSI.

In addition, I hope to be able to tell whether the two species of Funaria (F. hygrometrica and F. flavicans) are hybridizing in nature. I would do this by examining populations where they are sympatric, and comparing them to populations which are allopatric. If the microsatellites show that the two species are more similar (by having more similar microsatellite profiles) when they are in sympatry than when in allopatry, it is likely that they are sharing genes.

Definition Train: Sympatry

It is my ongoing goal to explain, in common terms, what it is that I'm doing with this half-decade in graduate school. To that end, I'm hoping to make everyone familiar with certain terms; once you understand them, they're no longer over-your-head jargon! So every so often at the Gametophyte Junction we'll hop on the definition train. First up: sympatry.

Sympatry, like many biology terms, is a word derived from Greek: sym/syn- (meaning same), -patry (meaning fatherland). Two species are therefore sym-patric when they share the same fatherland; they have ranges which overlap. The opposite of sympatry is allopatry, meaning different-fatherland, and describes two species which have non-overlapping ranges. In between is parapatric, meaning adjacent-fatherland, and implying that the ranges of two species share a border (like two countries), or sometimes they have a narrow overlap range.

The concept of sympatry is important because of gene flow and speciation (the formation of new species). Initially, new species start out as populations, freely exchanging genes throughout the generations. The principles of population genetics have taught us that when a population has free gene flow, it is very tough to have different varieties. When a new variety emerges, three things usually happen: 1) The new variety is more adapted to the environment, and spreads quickly, wiping out the older varieties. 2) The new variety is less adapted to the environment, and vanishes quickly. 3) The new variety is neutral with respect to how adapted to the environment it is, and these varieties fluctuate until they are eventually lost or adopted by the whole population.

Species, meanwhile, under the Biological Species Concept, are not just observed by their separate and discontinuous variety. To achieve this discontinuity, there must be some barrier to gene flow between the population with the new variety and the other populations. Typically, this is done in allopatry- some geographic barrier (like a mountain or a body of water) separates two populations for an extended period of time. During this time, the two populations adapt to environments that are almost certainly different. These different adaptations may also change the organism in such a way that if the barrier were removed (a gap in the mountain, land bridge over the body of water), the two populations may have trouble mating. This creates the barrier to gene flow.

You'll notice that when the barrier is removed, the two populations are now in sympatry. It is usually at this point that species are truly formed- when two populations have reduced gene flow among them in sympatry. On a practical level, this manifests usually as "hybrid breakdown." Most people are familiar with the mule- it is an offspring of a horse and a donkey, but the mule itself is sterile. Because the horse and donkey adapted to different environments, they evolved genes that are slightly incompatible; enough to create a live child but one that is sterile. Having sterile offspring is definitely a barrier to gene flow. It is also a waste of resources, and natural selection typically leads such populations to methods of avoiding creating these bad hybrids. Animals recognize members of their own species through sight and sound; plants change pollinators or chemicals on the surfaces of gametes in an effort to only use precious reproduction resources on making good children.

What does this have to do with me? Well, by and large most of the work on mosses has not been under the Biological Species Concept. Bryologists over the years have been guided by the principles of taxonomy, grouping organisms in to species and genera and families based on similar characteristics. Whether two moss species have any barriers to gene flow is largely unknown. So it is entirely possible that the two species I'm studying, Funaria hygrometrica and Funaria flavicans, actually exchange genes. If so, then they are, in my opinion, one species. I'm bringing this up in part because of the following picture:



This was from my field trip, taken near Dillwyn, Virginia. The green capsules are F. hygrometrica and the smaller red capsules are F. flavicans. They are growing right next to each other, sympatrically. This is not a unique finding, my advisor wrote a paper in 1992 describing a mine site which had both species and what appeared to be intermediates. However, no DNA work was done to determine if there were hybrid plants. Some of the questions that intrigue me include:

Do the two species hybridize? If not, what barrier to gene flow separates them?
If hybrids form, are they less "fit" than their parents?
What genes control the separation of the species? Are there many genes or just a few?

For example, the F. flavicans in the picture above are red because they matured earlier than F. hygrometrica. Timing in plant matings are very important; if hybrids between the species were to mature at some intermediate time, they may not find many mates. That would make them less "fit" because "number of offspring" is the definition of fitness.

That's all for now; as always, feel free to ask questions if there's something unclear. I'm always willing to find new ways to explain things!

Days 6&7&9: Homeward Bound (with Pictures!)

So, it's been almost a week since my last post. I apologize for that, it has been a long busy week, and I've been splitting my time between the greenhouse and helping Rebecca find an apartment in Durham (she's working at the Duke Lemur Center next year!) I'd like to complete the series about my trip. I've also gotten my pictures uploaded, so I can finally share with you all some of the places I've been. Click HERE for the whole Google album!!!

Image embedding seems to not work very well, so I'm just going to link to pictures. Click on them for a thousand extra words. For starters, here's Funaria in all its glory.That's from Tompkins, County New York, near West Danby, in the really interesting population I talked about here.

We were able to collect two populations on Friday, one in Charlestown, Rhode Island and another in Plainfield, Connecticut. Oddly enough, they were both along railroad tracks parallel to side streets each named "Railroad Avenue." We didn't do too much else on Friday, although we did collect mosses from around Rhode Island and visited Beavertail Lighthouse, at the southern tip of Conanicut Island (in the sound between Providence and Newport). It's the third-oldest lighthouse in the US, according to the signs. Here's me at the lighthouse, trying not to be cold.

After making it home on Friday night we enjoyed an excellent meal of Carolina-style BBQ. Piers seemed to enjoy it despite his preference for Memphis-style, and I've been eating the leftovers back in Durham all week. On Saturday morning, Piers and I got up and traveled to the exotic location of... about a mile from our house, in the Wallkill River Wildlife Refuge. The Duke Herbarium has only six collections from Sussex, County NJ, and most of the collections in the New York Botanical Garden are pre-1950 or even pre-1900. So everything we collected was useful for bryologists in general. We went over to Vernon to the railroad tracks and found a quite extensive population of Funaria there.

There was also a very nice older man from the shops across the street, Dan Børstad. At first
he thought we were trash collectors, but after I explained what we were doing, he was still happy to talk to me. He was from Norway and said he had studied Botany when there, and I told him about all of our Norwegian colleagues who study Sphagnum up in the massive peat bogs. He also seemed impressed that I had returned all the way home just to collect the moss.

In the afternoon, Dad wanted to join us to see how the whole moss collecting operates. We were mostly searching for Sphagnum, which is the only moss that has been collected from the county. Most of the habitats we were looking at, however, looked more like this, which is far too eutrophic for Sphagnum.

We found a decent sized Funaria population (where I put Dad to work) in Sparta and hunted around for some of the previous localities for Sphagnum. One place we visited was Edison Pond, which I did not know existed. It's about 2 miles SSE of Ogdensburg, and was a series of mines funded by Thomas Edison in the early 1900s. He poured $2 million of his own money into the site to mine for iron, and employed 500 men at the peak of construction. There was no iron there, however, as the Hamburg Mountains are made almost entirely out of zinc and lime. The pond, and presumably the Sphagnum collected in 1986, were also gone.

Leaving Edison Pond, we headed up to High Point, and passed on entering the park itself to visit a swampy area at the base of Steenykill Lake, and found copious amounts of Sphagnum! Sadly, there weren't any sporophytes, but I'm hoping to come home again sometime in July, and perhaps I will be luckier then. The grad student working on them, however, is less convinced, and she thinks these species of Sphagnum never enter the sexual stage. How sad.

We settled in for an evening of Lasagana and a moss show-and-tell for my parents. The next morning we left, laden with moss and bagels from New Jersey, headed back to Durham. We stopped back in Bethesda for lunch, and then once in Catlett, Virginia to make a final Funaria collection.

It's going to be a lengthy job to sort out and document all the Funaria I collected during this trip. I had a lot of fun though, learning not just about the species I'm focusing on, but also gaining more field experience with mosses by traveling with such a knowledgeable guide. Even five days after returning, I'm thinking back upon what a whirlwind trip it was. I've already discovered some very intruiging things about the plants I collected this week; I hope to share some of those discoveries with you soon. So, by all means do not think that the end of my trip signals the end of my blogging- there's many more Fun(aria) to come!

Total Miles Traveled: 1,987
Total Funaria Populations: 18
Oil Pans Replaced: 1
Clichéd Advertising Reference: Priceless.

Day 5: All the Live-Long Day

Inevitably, everything that is exciting will eventually become mundane. An event that was once a "Eureka!" moment leading to instant happiness becomes routine, ordinary, and relatively uninteresting. This is how I feel about collecting Funaria; now that we have our senses tuned into the habitat of the plant, finding it is as easy as finding railroad tracks. These we found about ten miles from where we stayed in Maltaville, and again right along the Connecticut River, at the border between Vermont and New Hampshire. Finding Funaria, even large populations, is now routine and not very exciting. I can go from seeing train tracks to being back in the car with 20 sample bags within like twenty minutes.

This underscores another importance of general moss collecting, that I talked about yesterday. It breaks up the monotony of only collecting one plant from essentially one habitat, allowing me to explore dense forests and mountain streams to collect whatever I find interesting. Piers usually ends up staying out of the car longer than I, but that's okay, because it allows me to write and to plan our route. The collections will continue to interrupt the monotony when I get back to Durham, as well- it's going to get boring, measuring seta lengths and doing DNA extractions. Identifying mosses, meanwhile, is like solving a puzzle. I work my way through a giant key to mosses, looking at microscopic characters that distinguish families, genera, and species.

We were almost completely stumped by the state of New Hampshire. At least in the southern part of the state, they have turned all the unused railways into hiking trails, removing the rails, ties, and gravel. I joked that Funaria should be listed as critically endangered in the state if they continue to remove its precious habitat. We were only successful in finding two patches of Funaria flavicans, but at least we didn't totally strike out.

Massachusetts also had its interesting moments. Driving south to Worcester (which I will never be able to pronounce correctly, according to Mike's friend Max), we passed over some railroad tracks. We pulled into a side street to investigate and found Funaria same as ever. As I was collecting, I noticed Piers was gone, which is not unusual, since he sometimes wanders off in search of something less weedy. What was unusual was the two state trooper cars sitting next to mine on the road. Apparently across the street from these tracks was a state corrections facility, and the troopers were not too happy I was there. Luckily, though, one of them was a Marine who spent a lot of time in Camp Lejeune, and so was a Duke fan. I shared some stories with him and he let us go without much problem. Oh well, it's not a true field trip unless you run into the authorities at least once.

We got to Providence and hit a bit of a snag as the guy we were staying with wasn't at his apartment. While we waited for him, we took out some bags from the very first stop, at that lumber yard in central Virginia. We hadn't seen anything like the samples we collected since, and it maybe that most of the population isn't Funaria at all! We won't know for sure until we get back to the lab. The good news is that I know at least some of the plants are Funaria. On top of that, what really mattered that day is that we THOUGHT it was Funaria, because at that point we were really frustrated by our Funaria-detecting ability. We're experts now, and we know what to do- follow the trains.

I got to stop by Brown and see Mike, which was very nice- we played some tennis (exercise thoroughly confused my body, which has begun to mesh with my drivers' seat), got some pizza, and met with some of his friends. Tomorrow, I'm headed home, to Hardyston New Jersey, via Rhode Island, Connecticut, and southern New York. Mom has promised pulled pork BBQ, which I'm sure will be up to Piers' Arkansas standards!

Miles Traveled: 255
Funaria Populations: 4

Day 4: Misty Mountain Hop

Four years ago this month I had my first breakthrough in science- I was accepted into the NSF's Research Experience for Undergraduates program at Duke. The program was called "Bioinformatics and Systematics of Plants and Fungi." Many of the students were working on building phylogenies for the various groups of organisms they were interested in. I, on the other hand, was interested in speciation and just happened to be working on plants. The group went on a field trip to the Croatan National Forest in SE North Carolina and, walking around the savanna most of the other students were interested in all the different kinds of plants around. I was not, and I took some pretty pictures of flowers and trees, but I said to myself "I could never be as interested in plants the way those guys are. I just want to know about evolution."

Flash forward to April 30, 2008- a day I spent in the southern Adirondack Mountains doing nothing other than collecting as many different types of mosses- (mosses!) as I could find. 2004Matt would have slapped 2008Matt upside the head, "what the hell you wastin your time doin that for?!?" But he'd be wrong. What 2004Matt didn't understand is that you do need to care about the organisms in order to know about evolution. It's a pratical matter, as well: if I'm interested in a certain species, even if it's a model organism worked on almost entirely in the laboratory, I still need to collect specimens. In order to do that, I need to know how to find the species, and when I do collect it, I need to know what information to record about a site. So I need to know a lot about the ecology of the species, common associated other organisms, and a lot about its life cycle just to collect the organism.

So it's not enough to just claim that it doesn't matter what species I work on. While it's true that there are certain principles of evolution and genetics which broadly apply to all things (they do, after all, have DNA and are subject to natural selection). Still, it is the very qualities that make organisms unique which need to be accounted for during the whole process. I fear that some of my colleagues forget that, and I am very happy to have a serious field component of my research. Working on a group of organisms like mosses really lets me appreciate the diversity of life in new ways, in areas of forests that are usually trampled upon without thought.

To me, a day like I had in the Adirondacks was just as important as all the stops collecting Funaria. Yes, I'm going to be working on a particular species of moss, but it is still essential to understand the variation within the moss world, as each species has a unique method of living and reproducing. Getting myself locked in to one species would be a shame, so I didn't mind that we didn't collect Funaria at all in the Adirondacks. We didn't really look for it either, we just tried to collect interesting mosses in every NY county we passed on our way to Maltaville, NY at the end of the day.

When we got to the place we were staying, there were two other travelers staying there as well, a pair of men from Denmark, who are traveling all over the eastern US from March until June. Their purpose is to listen to Americans from all walks of life to get a sense of our culture. They're writing about it for their hometown newspaper and hope to get a book out of it. They also have a website, and I'm mentioned in there somewhere...

The next day is a whirlwind tour of three New England states: Vermont, New Hampshire, and Massachusetts, on our way to Providence, RI. I'm looking forward to meeting up with my brother, who goes to Brown, and Piers is looking forward to collecting in Rhode Island: the only eastern US state missing from his personal collection.

Miles Traveled: 243
Funaria populations: 0 (by design, but plenty of mosses collected!)