Next up stop for the definition train is not a concept but a technique, and one essential to my work. Microsatellites are also known as Short Tandem Repeats, and are DNA regions that contain a lot of repetitive DNA. Because they are very variable within a population, they're known as a "DNA Fingerprinting" technique, and are used for all kinds of purposes including forensics (they're featured on CSI quite often). Here's a little bit about how they are designed, and how they work.
Our DNA contains a lot of junk. That statement is less true than when it was first realized that despite the six billion base pairs of the human genome, less than a tenth of that is actually used for constructing proteins. Some of the rest of the genome is used to regulate gene expression, while much of it remains junk. However, junk is good for population geneticists, because junk DNA is not usually subject to natural selection; there aren't any constraints keeping a particular DNA sequence intact. They are free to vary according to the rules of chance, and those rules allow scientists to deduce how related two organisms are.
One type of these DNA regions contains repetitive bases- remember, the DNA code has four letters (A, G, C, and T). In these regions, the same two or three letters repeat many times. For example, it may look like this:
GATCAGTAAGATATATATATATATATATATATATATATATGGGTGCTCAGAT
In this case, this individual has the microsatellite "AT" repeated 16 times. The number of repeats turns out to be pretty variable, even within a population: one individual may have 16 repeats, as above, while a neighbor may have 12 repeats or 20 repeats. The interesting thing is that there are many of these regions (also known as loci) in the genome, and so one can have a pretty complete profile of an individual by looking at 5 to 15 of these loci:
Microsat Individual 1 Individual 2
1.............. 16................ 18
2............. 200 ............. 225
3.............. 75 ............... 75
4 ............. 87................ 90
5............ 103............... 115
This is a typical result of a microsat analysis; a machine reads off how many copies there are for each sample at each locus. With five loci, we can see that even though the two individuals are identical at locus 3, they are clearly two different individuals. Perhaps they are related, though. In forensics, crime labs will typically look at 13 loci to make a match between a suspect and a DNA sample from the crime scene. You might also hear on CSI or Court TV when it's said that the suspect has "7 of 13 alleles in common." What they mean is that at 7 of the 13 loci, two samples have identical numbers of repeats. This is extremely unlikely to be due to chance, and so it is pretty likely that the two samples come from DNA of blood-relatives (probably siblngs or parent-offspring).
It is one of my goals to investigate the matting patterns in mosses, by knowing who mates with whom. To do this, I need to find the regions (or loci) that have the microsatellites. Doing that from scratch is actually a time (3-4 months) and cost ($6000) intensive process. I'm fortunate that Funaria is in the same family as Physcomitrella, the lab rat of the moss world. Physcomitrella recently has its entire genome sequenced, and has a lot of researchers working on it, including those who have designed microsattelites for the species. In a paper, they also noted that many of the regions for Physcomitrella also work for Funaria. Those scientists have graciously supplied me with materials to discover whether those regions are variable enough for me to distinguish two moss individuals as they do with humans on CSI.
In addition, I hope to be able to tell whether the two species of Funaria (F. hygrometrica and F. flavicans) are hybridizing in nature. I would do this by examining populations where they are sympatric, and comparing them to populations which are allopatric. If the microsatellites show that the two species are more similar (by having more similar microsatellite profiles) when they are in sympatry than when in allopatry, it is likely that they are sharing genes.
Our DNA contains a lot of junk. That statement is less true than when it was first realized that despite the six billion base pairs of the human genome, less than a tenth of that is actually used for constructing proteins. Some of the rest of the genome is used to regulate gene expression, while much of it remains junk. However, junk is good for population geneticists, because junk DNA is not usually subject to natural selection; there aren't any constraints keeping a particular DNA sequence intact. They are free to vary according to the rules of chance, and those rules allow scientists to deduce how related two organisms are.
One type of these DNA regions contains repetitive bases- remember, the DNA code has four letters (A, G, C, and T). In these regions, the same two or three letters repeat many times. For example, it may look like this:
GATCAGTAAGATATATATATATATATATATATATATATATGGGTGCTCAGAT
In this case, this individual has the microsatellite "AT" repeated 16 times. The number of repeats turns out to be pretty variable, even within a population: one individual may have 16 repeats, as above, while a neighbor may have 12 repeats or 20 repeats. The interesting thing is that there are many of these regions (also known as loci) in the genome, and so one can have a pretty complete profile of an individual by looking at 5 to 15 of these loci:
Microsat Individual 1 Individual 2
1.............. 16................ 18
2............. 200 ............. 225
3.............. 75 ............... 75
4 ............. 87................ 90
5............ 103............... 115
This is a typical result of a microsat analysis; a machine reads off how many copies there are for each sample at each locus. With five loci, we can see that even though the two individuals are identical at locus 3, they are clearly two different individuals. Perhaps they are related, though. In forensics, crime labs will typically look at 13 loci to make a match between a suspect and a DNA sample from the crime scene. You might also hear on CSI or Court TV when it's said that the suspect has "7 of 13 alleles in common." What they mean is that at 7 of the 13 loci, two samples have identical numbers of repeats. This is extremely unlikely to be due to chance, and so it is pretty likely that the two samples come from DNA of blood-relatives (probably siblngs or parent-offspring).
It is one of my goals to investigate the matting patterns in mosses, by knowing who mates with whom. To do this, I need to find the regions (or loci) that have the microsatellites. Doing that from scratch is actually a time (3-4 months) and cost ($6000) intensive process. I'm fortunate that Funaria is in the same family as Physcomitrella, the lab rat of the moss world. Physcomitrella recently has its entire genome sequenced, and has a lot of researchers working on it, including those who have designed microsattelites for the species. In a paper, they also noted that many of the regions for Physcomitrella also work for Funaria. Those scientists have graciously supplied me with materials to discover whether those regions are variable enough for me to distinguish two moss individuals as they do with humans on CSI.
In addition, I hope to be able to tell whether the two species of Funaria (F. hygrometrica and F. flavicans) are hybridizing in nature. I would do this by examining populations where they are sympatric, and comparing them to populations which are allopatric. If the microsatellites show that the two species are more similar (by having more similar microsatellite profiles) when they are in sympatry than when in allopatry, it is likely that they are sharing genes.
No comments:
Post a Comment